Research Article | Volume 11, Issue 1, January, 2023

Evaluation of seven different wheat cultivars for their resistance to drought in terms of growth indicators and yield

Zeyad H. AL-Fatlawi Ali Nadhim Farhood Saleh Abed Alwahed Mahdi Auday Hamid Taha Al-Tmime   

Open Access   

Published:  Nov 22, 2022

DOI: 10.7324/JABB.2023.110126
Abstract

The study used a randomized complete block design with three replicates to investigate drought tolerance genes and wheat growth and yield. The experiment included seven wheat cultivars: Buhooth 158, Rasheed, Buhooth 22, Tahade, Fatih, N70, and Cimmyt 72 in main plots and three drought treatments: Irrigation after draining 50% of available water (D1), irrigation after draining 65% of available water (D2), and irrigation after draining 75% of available water (D3) in subplots. Drought treatments resulted in an increase in the expression of genes that promote drought resistance. It is also noted that the Buhooth 158 cultivar was superior by giving the highest relative expression of LOC100382183 and LOC103630223 gene, with averages of 2.41 and 2.25 times higher than the rest of the cultivars, and this leads us to think that the Buhooth 158 cultivar has a higher drought tolerance than the rest of the cultivars. It was found that the drought treatment (D3) had a significant impact on plant height and flag leaf area, as well as on the number of tillers, spikes, and grains in a spike. The decreases in these indicators were 12.76% for plant height, 25.89% for flag leaf area; 44.00% for tillers number; 49.31% for spike number; 40.00% for grain number; and 32.21% for the weight of 1000 grains, 43.55% for grain yield, 4.91% for biological yield, and 40.44% for harvest index. Cultivars Buhooth158, Rasheed, and Buhooth 22 surpassed the rest, with the highest average yield components, grain yield, biological yield, and harvest index all indicating their superior performance.


Keyword:     Gene expression Polymerase chain reaction Wheat Grain yield Biological yield Harvest index Water stress


Citation:

AL-Fatlawi ZH, Farhood AN, Mahdi SAA, Al-Tmime AHT. Evaluation of seven different wheat cultivars for their resistance to drought in terms of growth indicators and yield. J App Biol Biotech. 2023; 11(1):188-194. https://doi.org/10.7324/JABB.2023.110126

Copyright: Author(s). This is an Open Access article distributed under the terms of the Creative Commons Attribution-NonCommercial-ShareAlike license.

HTML Full Text

1. INTRODUCTION

Although the global average production of cereal crops such as wheat, barley, and rice per unit area for human nutrition has nearly doubled since the beginning of the 20th century thanks to research and those interested in breeding and improving these crops, wheat (Tritium aestivum L.) is still the world’s first crop in terms of total cultivable area and global production. One of the reasons for the decline in wheat productivity is drought, which is the most important determinant of crop production in dry and semi-arid areas, representing about 70% of potential losses [1], as it negatively affects agricultural production through its effect on plant growth, as it works to reduce the number of cells and tissue expansion. Consequently, the number of leaves and leaf area will drop, and the crop’s growth time will shorter, all of which will lead to a reduction in the crop’s components and, as a result, a reduction in the yield [2]. Negative water stress results from the drying out of the cells’ protoplasm. The loss of water leads to the shrinkage of the protoplasm, resulting in an increase in the concentration of solutions, which causes great damage [3]. Adaptation mechanisms of plant include metabolic and physiological changes, gene expression and transcription regulation, as well as epigenetic plasticity [4], these mechanisms allow plants to better withstand the effects of drought. In response to environmental conditions of water deficiency, a number of genes undergo expression and translation [5]. Drought stress response molecular pathways have been studied in a number of researches. These researches have led to the discovery of drought-responsive genes that are both conserved and unique to each species. This gene family contains proteins that help cells retain water, such as membrane stabilizers and late embryogenic abundant proteins (LEA) [6]. In addition, a number of heat shock proteins (HSPs) were discovered [7]. These HSPs are extremely important for maintaining the structure of proteins. In reaction to abiotic stress, the HSPs are principally in charge of unraveling some folded proteins and preventing protein denaturation [8]. Transcription factors that regulate and provide an adaptive response under drought stress include myeloblastosis, dehydration-responsive element binding, C-repeat binding factor, abscisic acid responsive elements binding factor, ABRE binding, NAM, ATAF1/2, and CUC2 protein-containing proteins (NAC), WRKY, and SNF1-related kinase 2. However, despite these successes, the gene network of drought stress response has not yet been entirely unraveled [9]. A further factor supporting the notion that the drought stress response is complex is the existence of numerous cultivars of drought-inducible genes [10]. As a result, uncovering mechanisms for drought tolerance will aid in the creation of new crop varieties that are better suited to areas that are more prone to experience drought as a result of climate change. As a result, crop productivity and food security will improve over the long term. As a result, according to Marcek et al. [11], enhancing plants’ drought resistance is sufficient to address the issue of drought. The identification of these genes in various types of crops using new biotechnology tools, including DNA-based markers, is one of the most effective indicators and an important tool that can be trusted to measure genetic diversity in crops that were in biological evolution, as opposed to phenotypic and biochemical characteristics, which may be affected by environmental factors and long-term growth processes, because DNA markers give a quintessential answer. Therefore, this study aimed to determine the drought tolerance levels of the studied wheat cultivars and to determine the gene expression values of the studied genes. This study aims to investigate drought tolerance genes and wheat growth and yield.


2. MATERIALS AND METHODS

The 2019–2020 winter season was used to conduct a field experiment. Iraqi wheat cultivars of various drought-tolerance genes were exposed to quantitative reverse transcription-polymerase chain reaction (PCR) (RT-qPCR) analysis to determine the impact on yield and yield components in Babil Governorate-Iraq. A randomized complete block design with three replicates, set up using split plots, was used. There were seven different wheat cultivars used in the experiment, all of which were found in the main plots, including Buhooth 158, Rasheed, Buhooth 22, Tahade, Fatih, N70, and Cimmyt 7, and three treatments of drought treatments: Irrigation after draining 50% of the available water (D1), irrigation after draining 65% of the available water (D2), and irrigation after draining 75% of the available water (D3), within subplots.

2.1. DNA Extraction

At the vegetative stage, 10 leaves were collected from each of the following cultivars: Buhooth 158, Rasheed, Buhooth 22, Tahade, Fatih, N70, and Cimmyt 7. After that, the DNA was extracted with the ZR Plant DNA Extractor Kit from the samples. The company’s instructions for the R2144 kit were then followed.

2.2. PCR Technology

For seven wheat cultivars, the Korean company iNtRoN offered the MaximeTM PCR PreMix (i-Taq) kit (Kit No. 25025) for the PCR test. Drought tolerance genes were detected using the primers listed in Table 1.

Table 1: Primer list for PCR.

Gene symbolForward primerProduct length (bp)Gene description
LOC100194201F 5’AATGAGAGCACCTAGAGGGGG’3 R 5’TCGGGAAGTGATTAACGGCG’3950Ran BP2/NZF zinc finger-like superfamily protein
LOC103630223F 5’3GCAACGGCTTTAGTGACGTG R 5’ AAAGACTTGGCTGTGTGCAG’3905Granule-bound starch synthase 1 chloroplastic/amyloplastic
LOC100382183F’ 5CTTGTGACCCGATTTGCAGC’3 R 5’CCGCAGAGAAGGTTTGGACA’3831Glycerol-3-phosphate acyltransferase 1
LOC103634810F 5’TCGGCCATGGAAGACAGACT’3 R 5’TAAAATGTGTCGGCGTTTCGAG’3741Cytochrome P450 family 77 subfamily A polypeptide 5 pseudogene

PCR: Polymerase chain reaction.

The reaction mixture was prepared in a sterile tube (one for each genotype with a tube free of DNA, a negative control) and its components were mixed using a micro pipette and then placed in a centrifuge to maintain the final volume of the reaction mixture. Then, it was placed in a PCR device, and the reaction was carried out according to the program shown in Table 2 for the purpose of amplifying drought tolerance genes.

Table 2: PCR reaction conditions program.

StepTemperatureTimeCycle
Denaturation Initial955 min
Denaturation9540 s
Annealing6540 s40 cycles
Extension722 min
Extension725 min

PCR: Polymerase chain reaction.

After the completion of the PCR reaction, electrophoresis was performed, and pictures of the electrophoresis were taken.

2.3. RNA Extraction

Each experimental unit had 10 leaf samples obtained at the vegetative stage. Plant RNA was isolated using the ZR plant kit. Afterward, we followed the instructions in the kit’s instruction manual (Kat. No. R2024) to extract RNA.

2.4. RT-qPCR to Measuring Drought Tolerance Genes Expression

Ribonucleic acid was detected by RT-qPCR using the GoTaq® qPCR Master Mix (Cat. No. A6120) kit from Promega and a qPCR primer designed specifically for this test [Table 3].

Table 3: Primer for qPCR.

Gene symbolForward primerProduct length (bp)
LOC100194201F: 5’ GCTTCAGGTGCTCTGCCTAC’3R: 5’ TTCCATCCTGCTAGCGAAGT ’3122
LOC103630223F: 5’ CACATGGTTCTGTGCCTGAG’3R: 5’ TCCTCCTCATCTGGCTCATC ’3132
LOC100382183F: 5’ CAGGAGGAAGGTGGCGGT ’3R: 5’ TGCGTGCACACGTAGAGG ‘3128
LOC103634810F: 5’ GTCCATCCAGATTGCTCGTT ‘3R: 5’ CTGTGAACTGGTTGCTCGAA ‘3141

Afterward, it was inserted into the real-time PCR and run through the steps outlined in Table 4.

Table 4: Program for real-time PCR reactions.

StepTemperature (Cº)TimeCycle number
cDNA synthesis45.0°C30 minHold
Denaturation Initial95.0°C2 minHold
Denaturation95.0°C20 s40
Annealing65.0°C20 s
Extension72°C1 min

PCR: Polymerase chain reaction.

Using Marcek et al. [11] approach, the relative gene expression was estimated following the conclusion of the interaction:

Relative Gene Expression=2-ΔΔct

A target gene’s cycle threshold is indicated by the variable ct target, ct GAPDH is the reference gene’s cycle threshold (GAPDH(. It is the difference between the cycle threshold of the target gene and that of the reference gene for the samples tested. Differences in cycle thresholds between the target gene and reference gene for control samples are referred to as (ct. control).

2.5. Studied Traits

The following are the results of measurements made in the field:

  • Plant height (cm): Average of 10 plants from each experimental unit, from soil surface to spike.

  • Area of flag leaf (cm2): The following equation gives the average of ten readings from each experimental unit.

Area of flag leaf =Leaf length × leaf width at center × 0.75

  • Number of tillers (tiller m−2): Each experimental unit’s harvested tillers per square meter at crop maturity.

  • Number of spikes (spike m−2): The number of spikes per square meter of each experimental unit.

  • Number of grains in the spike (grain. spike−1): It was the average of 20 randomly selected spikes per harvested square meter.

  • 1000 grain weight (g): One thousand grains were randomly selected from each experimental unit’s previously harvested square meter and weighed with a sensitive scale.

  • Grain yield (ton ha-1): Each experimental unit’s square meter was harvested, dried, and translated to tons ha-1.

  • Biological yield (ton ha-1): Each experimental unit’s square meter was harvested, dried, weighed (stems, leaves, and spike), and converted to tons ha-1.

  • Harvest index: The equation was:


3. RESULTS AND DISCUSSION

After PCR reaction conditions were created, the PCR products were electrophoresed for wheat cultivars (Buhooth158 [V1], Rasheed [V2], Buhooth22 [V3], Tahade [V4], Fatih [V5], N70 [V6], and Cimmyt 7 [V7]) on agarose gel with a 1 KB ladder. The results of Figure 1 showed the presence of bands with molecular weights (950 bp, 905 bp, 831 bp, and 741 bp) in the seven cultivars representing the genes responsible for drought tolerance investigated in this study.

Figure 1: Electrophoresis of the PCR reaction products for four primers and for seven cultivars of wheat (Buhooth 158 [V1], Rasheed [V2], Buhooth 22 [V3], Tahade [V4], Fatih [V5], N70 [V6], and Cimmyt 7 [V7]) with a negative control (N.C) without adding DNA to the rest of the components required for the polymerase chain reaction. Also, the presence of a DNA ladder (m).



[Click here to view]

Although the collection of wheat cultivars possessed these genes responsible for drought tolerance, these cultivars differed in their tolerance to drought tolerance, so by studying the gene expression of these genes in the seven wheat cultivars, we were able to understand the reason for the varietal differences in their tolerance to drought tolerance. Figure 2 shows that these four genes increase their gene expression with increasing levels of drought, and this confirms the findings of Livak and Schmittgen [12] that these genes respond to drought significantly and work to raise drought tolerance through several mechanisms.

Figure 2: Relative gene expression response of drought stress tolerance genes in wheat cultivars.



[Click here to view]

It also appears from Figure 2, that the cultivars Buhooth 158, Rasheed, and Buhooth 22 were characterized by higher gene expression compared to the rest of the cultivars, especially in the genes (LOC100194201 gene, LOC103630223 gene, and LOC100382183 gene). It is also noted that the Buhooth 158 cultivar was superior by giving the highest relative expression of the LOC100382183 gene and the LOC103630223 gene, with averages 2.41 and 2.25 times higher than the rest of the cultivars, and this leads us to think that the Buhooth 158 cultivar has a higher drought tolerance than the rest of the cultivars.

According to Table 5, drought at treatment D3 resulted in significant decreases in wheat plant height, flag leaf area, and tiller number, with respective percentages of 12.76%, 25.89%, and 44.00%. Treatment D3 was the only one to exhibit a significant difference in these variables. The decrease in the rate of total photosynthesis and the decrease in water potential, which resulted in a reduction in stem cell elongation, division, and expansion due to the decrease in the water potential of plant cells, are responsible for the reduction in vegetative growth characteristics in wheat with increasing drought intensity in the treatment of D3 [13,14]. The reason for the wheat plant’s reduced height after water stress may be due to the breakdown of auxin because it does not have the opportunity to work on the elongation of the internodes and the lack of development of the ridges [15]. It also has to do with the fact that plants cannot get enough nutrients, especially nitrogen, because there is not enough water in the soil. Another Table 5 result shows Buhooth 158, Rasheed, AB99, and Buhooth 2299 cultivars to be the most productive wheat cultivars for crop height, flag leaf area, and tillers.

Table 5: Effect of drought stress treatment on a number of vegetative growth treats for seven wheat cultivars.

Drought stressCultivarsPlant height (cm)Flag leaf area (cm2)No. of tillers (tiller m-2)
D1Buhooth 15894.2546.76522.43
Rasheed123.5452.36587.62
Buhooth 22104.5651.57593.37
Tahade111.7451.78614.65
Fatih84.2545.78507.72
N70114.6551.44583.33
Cimmyt 796.2842.76430.00
D2Buhooth 15893.8945.82496.31
Rasheed122.5551.31558.24
Buhooth 22102.7350.53563.70
Tahade109.8650.74583.92
Fatih83.9144.86482.33
N70110.6050.41554.16
Cimmyt 794.7041.90408.50
D3Buhooth 15876.1032.02292.56
Rasheed105.1439.27329.07
Buhooth 2292.2938.67332.29
Tahade98.7638.83344.20
Fatih75.2134.33284.32
N7099.4338.58326.66
Cimmyt 789.2532.07240.80
LSD 0.058.123.6424.28

Table 6 shows that the number of spikes, the number of grains in each spike, and the weight of 1000 grains for the wheat crop showed significant difference between the drought treatments. Treatment D3’s drought reduced these traits by 49.31%, 40.00%, and 32.21%, respectively. Treatment D3’s drought was the most severe. This is the reason for this. As the severity of drought increased, the number of tillers in the D3 treatment decreased [Table 5], and this was reflected in the number of spikes. The lack of photosynthesis and interception of sunlight caused by the drought also reduced the amount of dry matter needed to produce grains, resulting in a drop in grain weight. This, in turn, reduced the amount of dry matter needed to produce grains.

Table 6: Effect of drought stress treatment on yield components for seven wheat cultivars.

Drought stressCultivarsNo. of spike (spike m-2)Number of grains in spike (grain spike-1)1000 grain weight (g)
D1Buhooth 158417.9450.9644.65
Rasheed470.1056.0744.97
Buhooth 22474.7056.5244.23
Tahade491.7258.1943.93
Fatih406.1849.8144.76
N70466.6655.7344.03
Cimmyt 7344.0043.7144.69
D2Buhooth 158397.0548.9143.31
Rasheed446.5953.7743.62
Buhooth 22450.9654.1942.90
Tahade467.1355.7842.61
Fatih385.8747.8143.42
N70443.3353.4542.71
Cimmyt 7326.8042.0343.35
D3Buhooth 158256.7835.1632.67
Rasheed230.3532.5730.13
Buhooth 22232.6032.7929.63
Tahade240.9433.6129.43
Fatih199.0329.5029.99
N70228.6732.4129.50
Cimmyt 7168.5626.5229.94
LSD 0.0527.682.878.56

It was also noted that the Buhooth 158 cultivar under the influence of drought (D3) was superior in the number of spikes (256.78 spike m-2) and the number of grains in the spike (35.16 grain spike-1) and the weight of 1000 grains (32.76 g) by giving it the highest averages for this treats, outperforming the rest of the cultivars, and this was confirmed by relative gene expression results [Figure 2] that the Iraqi cultivar was superior by giving it the highest relative expression of LOC100382183 gene and LOC103630223 gene, which enabled it to drought tolerance.

Table 7 shows that the grain yield, biological yield, and harvest index for the wheat crop were all different between the different study treatments, with 43.55%, 4.91%, and 40.44%, respectively, of these traits getting worse in treatment D3, the drought made a big difference. This decrease is attributed to the drought. It worked to reduce the yield components (no. of spikes, no. of grains, and weight of the grain) and thus work to decrease grain yield, in addition to a drop in biological yield due to a decrease in plant growth parameters (plant height, flag leaf area, and the number of tillers) [16], in addition to the fact that drought caused a decrease in the accumulation of dry matter for plants [17] as a result of the lack of vegetative growth and then reducing the interception of solar rays and the decrease in the conversion of solar energy into chemical energy as a result of closing stomata, increasing respiration and the occurrence of disturbances in biochemical processes [18].

Table 7: Effect of drought stress treatment on grain yield, biological yield, and harvest index for seven wheat cultivars.

Drought stressCultivarsGrain yield (ton h-1)Biological yield (ton h-1)Harvest index
D1Buhooth 1585.6415.6636.03
Rasheed5.9617.4134.23
Buhooth 225.8716.2736.07
Tahade4.8516.7029.03
Fatih4.9615.0632.95
N705.8116.8834.42
Cimmyt 74.6515.7829.47
D2Buhooth 1585.4715.6334.99
Rasheed5.7817.3533.32
Buhooth 225.6916.1635.23
Tahade4.7016.5928.35
Fatih4.8115.0332.00
N705.6416.6433.88
Cimmyt 74.5115.6828.76
D3Buhooth 1583.9714.5727.26
Rasheed3.2216.3119.73
Buhooth 223.1715.5420.40
Tahade2.6215.9316.45
Fatih2.6814.5118.46
N703.1415.9719.65
Cimmyt 72.5115.3616.35
LSD 0.050.120.730.85

Table 7 further revealed that the cultivars Buhooth 158, Rasheed, and Buhooth 22 produced the highest grain yields, biological yields, and harvest indexes for wheat crops when compared to the other cultivars studied. It was shown that the Buhooth 158 cultivar had the highest genetic expression of the genes responsible for drought resistance, which made it the least affected by drought (D3) for grain production, biological yield, and harvest index.


4. CONCLUSION

These results enable us to conclude that the LOC100382183 gene and the LOC103630223 gene are the most responsive to drought stress and that the Buhooth158 cultivar has been able to resist drought conditions due to the increased expression of these two genes.


5. ACKNOWLEDGMENT

Authors are thankful to the Department of Department of Field Crops, Agriculture College, Kerbala University, for provide us with varieties of wheat.


6. AUTHORS’ CONTRIBUTIONS

All authors made substantial contributions to conception and design, acquisition of data, or analysis and interpretation of data; took part in drafting the article or revising it critically for important intellectual content; agreed to submit to the current journal; gave final approval of the version to be published; and agree to be accountable for all aspects of the work. All the authors are eligible to be an author as per the international committee of medical journal editors (ICMJE) requirements/guidelines.


7. FUNDING

There is no funding to report.


8. CONFLICTS OF INTEREST

The authors report no financial or any other conflicts of interest in this work.


9. ETHICAL APPROVALS

This study does not involve experiments on animals or human subjects.


10. DATA AVAILABILITY

This article contains all of the generated data as well as the analyses of that data.


11. PUBLISHER’S NOTE

This journal remains neutral with regard to jurisdictional claims in published institutional affiliation.

REFERENCES

1.  Sallam A, Alqudah AM, Dawood MF, Baenziger PS, Börner A. Drought stress tolerance in wheat and barley:Advances in physiology, breeding and genetics research. Int J Mol Sci 2019;20:3137. [CrossRef]

2.  Guo R, Shi L, Jiao Y, Li M, Zhong X, Gu F, et al. Metabolic responses to drought stress in the tissues of drought-tolerant and drought-sensitive wheat genotype seedlings. AoB Plants 2018;10:ply016. [CrossRef]

3.  Itam M, Mega R, Tadano S, Abdelrahman M, Matsunaga S, Yamasaki Y, et al. Metabolic and physiological responses to progressive drought stress in bread wheat. Sci Rep 2020;10:17189. [CrossRef]

4.  Chaichi M, Sanjarian F, Razavi K, Gonzalez-Hernandez JL. Analysis of transcriptional responses in root tissue of bread wheat landrace (Triticum aestivum L.) reveals drought avoidance mechanisms under water scarcity. PLoS One 2010;14:e0212671. [CrossRef]

5.  Luna CM, Pastori GM, Driscoll S, Groten K, Bernard S, Foyer CH. Drought controls on H2O2 accumulation, catalase (CAT) activity and CAT gene expression in wheat. J Exp Bot 2005;56:417-23. [CrossRef]

6.  Hou J, Huang X, Sun W, Du C, Wang C, Xie Y, et al. Accumulation of water-soluble carbohydrates and gene expression in wheat stems correlates with drought resistance. J Plant Physiol 2018;231:182-91. [CrossRef]

7.  Khan S, Anwar S, Yu S, Sun M, Yang Z, Gao ZQ. Development of drought-tolerant transgenic wheat:Achievements and limitations. Int J Mol Sci 2019;20:3350. [CrossRef]

8.  Bi H, Miao J, He J, Chen Q, Qian J, Li H, et al. Characterization of the wheat heat shock factor TaHsfA2e-5D conferring heat and drought tolerance in Arabidopsis. Int J Mol Sci 2022;23:2784. [CrossRef]

9.  Yang Y, Al-Baidhani HH, Harris J, Riboni M, Li Y, Mazonka I, et al. DREB/CBF expression in wheat and barley using the stress-inducible promoters of HD-Zip I genes:Impact on plant development, stress tolerance and yield. Plant Biotechnol J 2020;18:829-44. [CrossRef]

10.  Wang H, Zhu Y, Yuan P, Song S, Dong T, Chen P, et al. Response of wheat DREB transcription factor to osmotic stress based on DNA methylation. Int J Mol Sci 2021;22:7670. [CrossRef]

11.  Marcek T, Hamow KÁ, Végh B, Janda T, Darko E. Metabolic response to drought in six winter wheat genotypes. PLoS One 2019;14:e0212411. [CrossRef]

12.  Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2022;25:402-8. [CrossRef]

13.  Zenda T, Liu S, Wang X, Liu G, Jin H, Dong A, et al. Key maize drought-responsive genes and pathways revealed by comparative transcriptome and physiological analyses of contrasting inbred lines. Int J Mol Sci 2019;20:1268. [CrossRef]

14.  Abid M, Ali S, Qi LK, Zahoor R, Tian Z, Jiang D, et al. Physiological and biochemical changes during drought and recovery periods at tillering and jointing stages in wheat (Triticum aestivum L.). Sci Rep 2018;8:4615. [CrossRef]

15.  Qaseem MF, Qureshi R, Shaheen H. Effects of pre-anthesis drought, heat and their combination on the growth, yield and physiology of diverse wheat (Triticum aestivum L.) genotypes varying in sensitivity to heat and drought stress. Sci Rep 2019;9:6955. [CrossRef]

16.  Farhood AN, Merza NA, Shukan MM, Mohammed AA, Taha, AH. Role of plant growth regulators in gene expression of SGR gene responsible for stay green of wheat varieties. Syst Rev Pharm 2020;11:1111-20.

17.  Yadav AK, Carroll AJ, Estavillo GM, Rebetzke GJ, Pogson BJ. Wheat drought tolerance in the field is predicted by amino acid responses to glasshouse-imposed drought. J Exp Bot 2019;70:4931-48. [CrossRef]

18.  Senapati N, Stratonovitch P, Paul MJ, Semenov MA. Drought tolerance during reproductive development is important for increasing wheat yield potential under climate change in Europe. J Exp Bot 2019;70:2549-60. [CrossRef]

Reference

1. Sallam A, Alqudah AM, Dawood MF, Baenziger PS, Börner A. Drought stress tolerance in wheat and barley: Advances in physiology, breeding and genetics research. Int J Mol Sci 2019;20:3137. https://doi.org/10.3390/ijms20133137

2. Guo R, Shi L, Jiao Y, Li M, Zhong X, Gu F, et al. Metabolic responses to drought stress in the tissues of drought-tolerant and drought-sensitive wheat genotype seedlings. AoB Plants 2018;10:ply016. https://doi.org/10.1093/aobpla/ply016

3. Itam M, Mega R, Tadano S, Abdelrahman M, Matsunaga S, Yamasaki Y, et al. Metabolic and physiological responses to progressive drought stress in bread wheat. Sci Rep 2020;10:17189. https://doi.org/10.1038/s41598-020-74303-6

4. Chaichi M, Sanjarian F, Razavi K, Gonzalez-Hernandez JL. Analysis of transcriptional responses in root tissue of bread wheat landrace (Triticum aestivum L.) reveals drought avoidance mechanisms under water scarcity. PLoS One 2010;14:e0212671. https://doi.org/10.1371/journal.pone.0212671

5. Luna CM, Pastori GM, Driscoll S, Groten K, Bernard S, Foyer CH. Drought controls on H2O2 accumulation, catalase (CAT) activity and CAT gene expression in wheat. J Exp Bot 2005;56:417-23. https://doi.org/10.1093/jxb/eri039

6. Hou J, Huang X, Sun W, Du C, Wang C, Xie Y, et al. Accumulation of water-soluble carbohydrates and gene expression in wheat stems correlates with drought resistance. J Plant Physiol 2018;231:182-91. https://doi.org/10.1016/j.jplph.2018.09.017

7. Khan S, Anwar S, Yu S, Sun M, Yang Z, Gao ZQ. Development of drought-tolerant transgenic wheat: Achievements and limitations. Int J Mol Sci 2019;20:3350. https://doi.org/10.3390/ijms20133350

8. Bi H, Miao J, He J, Chen Q, Qian J, Li H, et al. Characterization of the wheat heat shock factor TaHsfA2e-5D conferring heat and drought tolerance in Arabidopsis. Int J Mol Sci 2022;23:2784. https://doi.org/10.3390/ijms23052784

9. Yang Y, Al-Baidhani HH, Harris J, Riboni M, Li Y, Mazonka I, et al. DREB/CBF expression in wheat and barley using the stress-inducible promoters of HD-Zip I genes: Impact on plant development, stress tolerance and yield. Plant Biotechnol J 2020;18:829-44. https://doi.org/10.1111/pbi.13252

10. Wang H, Zhu Y, Yuan P, Song S, Dong T, Chen P, et al. Response of wheat DREB transcription factor to osmotic stress based on DNA methylation. Int J Mol Sci 2021;22:7670. https://doi.org/10.3390/ijms22147670

11. Marcek T, Hamow KÁ, Végh B, Janda T, Darko E. Metabolic response to drought in six winter wheat genotypes. PLoS One 2019;14:e0212411. https://doi.org/10.1371/journal.pone.0212411

12. Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-time quantitative PCR and the 2(-Delta Delta C(T)) method. Methods 2022;25:402-8. https://doi.org/10.1006/meth.2001.1262

13. Zenda T, Liu S, Wang X, Liu G, Jin H, Dong A, et al. Key maize drought-responsive genes and pathways revealed by comparative transcriptome and physiological analyses of contrasting inbred lines. Int J Mol Sci 2019;20:1268. https://doi.org/10.3390/ijms20061268

14. Abid M, Ali S, Qi LK, Zahoor R, Tian Z, Jiang D, et al. Physiological and biochemical changes during drought and recovery periods at tillering and jointing stages in wheat (Triticum aestivum L.). Sci Rep 2018;8:4615. https://doi.org/10.1038/s41598-018-21441-7

15. Qaseem MF, Qureshi R, Shaheen H. Effects of pre-anthesis drought, heat and their combination on the growth, yield and physiology of diverse wheat (Triticum aestivum L.) genotypes varying in sensitivity to heat and drought stress. Sci Rep 2019;9:6955. https://doi.org/10.1038/s41598-019-43477-z

16. Farhood AN, Merza NA, Shukan MM, Mohammed AA, Taha, AH. Role of plant growth regulators in gene expression of SGR gene responsible for stay green of wheat varieties. Syst Rev Pharm 2020;11:1111-20.

17. Yadav AK, Carroll AJ, Estavillo GM, Rebetzke GJ, Pogson BJ. Wheat drought tolerance in the field is predicted by amino acid responses toglasshouse-imposed drought. J Exp Bot 2019;70:4931-48. https://doi.org/10.1093/jxb/erz224

18. Senapati N, Stratonovitch P, Paul MJ, Semenov MA. Drought tolerance during reproductive development is important for increasing wheat yield potential under climate change in Europe. J Exp Bot 2019;70:2549-60. https://doi.org/10.1093/jxb/ery226

Article Metrics
265 Views 79 Downloads 344 Total

Year

Month

Related Search

By author names

Similar Articles

Isolation and in silico characterization of full-length cinnamyl alcohol dehydrogenase gene involved in lignin biosynthesis in Neolamarckia cadamba

Boon-Ling Tchin, Wei-Seng Ho, Shek-Ling Pang

Rapid and sensitive method for detection of Staphylococcus aureus enterotoxin genes in milk sample

Mahantesh M Kurjogi, Basappa B Kaliwal

Simplified detection of the asymmetric polymerase chain reaction-amplified DNA and its application in the target identification

G Suhasa, Savithri Bhat

Biosynthesis of biodegradable polymer by a potent soil bacterium from a stress-prone environment

Ningthoujam Chandani, Pranab Behari Mazumder, Amitabh Bhattacharjee

Enhancement of pigment production potential of Serratia marcescens (GBB151) through mutation and random amplified polymorphic deoxyribonucleic acid analysis of its mutants

Cecilia Nireti Fakorede, Babamotemi Oluwasola Itakorode, Olu Odeyemi, Gbolahan Babalola

Development and validation of multiplex polymerase chain reaction assay for concomitant detection of genus Staphylococcus and clinically relevant methicillin resistance determinants

Nimita Venugopal, Feroze Ganaie, Susweta Mitra, Rituparna Tewari, Tushar K. Dey, Rakshith Ojha, Rajeswari Shome, Bibek R. Shome

Expression of FUB-1 and FUB-11 as Toxic genes responsible for virulence during pathogenesis and combination of biocontrol agents in inhibition of Fusaric acid of Fusarium oxysporum causing Fusarium wilt of Arachis hypogaea L.

Pilli Rajeswari

Effect of nutrient media enhanced with plant growth regulators on genetic stability in sub-cultures of Digitalis purpurea callus

Mohammed Ahmed AL-Oqab, Salim Zaid, Youssef Al-Ammouri, Shawqi H. Alawdi

Begomovirus detection in the whitefly Bemisia spp. on eggplant Solanum melongena L. leaves

Rachmi Putri, Prasetya Anugerah Gusti, Nastiti Wijayanti

Characterization of Bean common mosaic virus strain blackeye cowpea mosaic infecting cowpea (Vigna unguiculata (L.) Walp.) in Egypt

Naglaa A.R. EL-Sayed, Amro A. Farrag, Noura H. Mohamed, Om-Hashim M. EL-Banna, Moustafa A.S. EL-Kady

Application of the PCR and allele-specific PCR-nucleic acid lateral flow immunoassay for the detection of the SRY gene and the G1138A mutation in the FGFR3 gene for the human DNA

Anupong Sukjai, Theerapong Puangmali, Khunton Wichajarn, Monthira Monthatong

Molecular epidemiology of Mycobacterium avium subspecies paratuberculosis in different captive wild animals

Swarup Sadashiv Lingayat, Tawheed Ahmad Shafi, Bhagwat Sopanrao Naikwade, Meera Pundlikrao Sakhare, Md. Ferozoddin Siddiqui, Prashant Ramchandra Suryawanshi, Abdul Mujeeb Syed, Abdul Qayoom Mir, Kunda Kumar Chaubey,, Saurabh Gupta, Manthena Navabharath, Mohd Abdullah, Pranchal Rajput, Shoor Vir Singh

Characterisation of actin depolymerising factor promoter (pTZPaADF) from Plectranthus amboinicus Lour (Spreng) using Arabidopsis thaliana (L.) Heynh as an internal control

S. M. Evangelene Christy, K. Aravind, V. Deepika, E. Steffi Selvarani, V. Arun

Evaluation of antibiotic resistance and quorum sensing assay of Enterococcus faecalis isolates from the urine samples

Ankita Jaigopal Sagar, Ajay Kumar Oli, Apoorva Jain, R. Kelmani Chandrakanth

Standardization of reference genes for real-time PCR analysis of Vigna radiata L. under Agrobacterium tumefaciens infection

V. M. Nivya, Jasmine M. Shah

Identification of differential expressed genes and its related pathways in Hela cell line treated with urea noscapine as potent anticancer agent

Animesh Pattnaik, Pradeep Kumar Naik

Steviol glycoside biosynthesis pathway gene expression profiling of transformed and non-transformed plant leaf tissues of Stevia rebaudiana (Bertoni)

Priya Singh, Amol S. Phule, Heena Tabassum, Minal Wani

Identification, evaluation and optimization of a minimum simple sequence repeat marker set for triticale breeding

W.C. Botes and D. Bitalo

Changes in chromatin active fraction of germinating seedlings of wheat under the effect of EMI EHF

P.O. Vardevanyan,M.A. Parsadanyan,M.A. Shahinyan,M.R. Darbinyan

An insight into wheat haploid production using wheat x maize wide hybridization

Anjanabha Bhattacharya, Bhavesh Palan, Bharat Char

Beneficial effects of soaking and germination on nutritional quality and bioactive compounds of biofortified wheat derivatives

Meena Verma, Vinod Kumar, Imran Sheikh, Punesh Sangwan, Roop Singh Bora, Ajar Nath Yadav, Harcharan Singh Dhaliwal

Sensing oxy anodic microbial fuel cell potential of halotolerant protease producer Priestia megaterium BorS17B13 belonging to mangrove biota

Priyanka S. Sawant, Jignasha T. Thumar

Effect of substitution wheat with Fagopyrum esculentum flour and Moringa oleifera leaf powder on the nutritional and sensory characteristics of cookies

Rekha Kaushik, Shiv Kumar, Swarnim Thussu, Poonam Khanna, Rahul Mehra

Optimizing solid-state fermentation for metabolite enrichment by Aspergillus tamarii on rice bran and wheat

Syaefudin Suminto,, Arthur Alba Huang, Uswatun Hasanah, Waras Nurcholis,

Variability in Indian wheat germplasm for important quality and physiological traits

Sabhyata Sabhyata,, Arun Gupta, Diwakar Aggarwal, Ratan Tiwari, Ruchika Sharma, Ankush Kumar, Gyanendra Singh

Screening and identification of heat tolerance in Indian wheat genotypes using generalized regression neural network (GRNN) model

Anil Kumar, Sadaf Fatima, Iffat Azim, Anshika Negi, Shalini Bhadola, Pooja Jha, Suboot Hairat

Optimization for nutritional fortification of wheat–millet composite flour mixture by response surface methodology

Gaurav Chaudhary, Monu Kumar, Anita Rani Sehrawat, Sandeep Kumar, Sachidanand Tripathi

Comprehensive evaluation of agronomic and qualitative characteristics in selected wheat cultivars in Kosovo

Njomza Gashi,

Leaf area index, quality, and nutrient uptake in wheat (Triticum aestivum L.) affected by different planting patterns and nitrogen levels

Harmanpreet Kaur Gill, Ujagar Singh Walia

Studies on component of genetic variance, combining ability and heterotic response for yield and yield components in wheat (Triticum aestivum L.)

Tukur Sani Bubuche, Shiv Prakash Shrivastav

Impact of fresh and residual biochar on physiological attributes and grain quality of wheat (Triticum aestivum L.)

Gaurav Sharma, Diptanu Banik, Chandra Mohan Mehta, Eiji Nishihara, Kazuyuki Inubushi, Shigeto Sudo, Sachiko Hayashida, Prabir K. Patra

Comparative investigation of the productivity and enzyme profiles of Pleurotus florida with supplementation of Groundnut and Neem seed cake

Roshan Lal Gautam, Yashvant Patel, Siya Ram, Ram Naraian

Integrated proteo-metabolomics reveal molecular mechanisms of wheat growth promotion and yield enhancement by PGPB–AMF microbial consortia under field conditions

Radheshyam Yadav, Pankaj Ror, Wusirika Ramakrishna

Assessment of agronomic trait and tolerance indices on yield parameters in eight barley (Hordeum vulgare L.) accessions under salt stress

Rajeswari Somasundaram, A. Somasundaram

Boosting agronomic traits and enhancing water use efficiency in rice lines incorporated with qDTY3.1 and qDTY2.1

Vignesh Palani, Sunitha Selvaraj, Karthika Muthuswamy, Bharathkumar Srinivasan, Selvaraj Jagannathan, Maghimaa Mathanmohun

Introgression of qDTY1.1 into genetic background of a modern rice variety (ADT36) and field performance under different environmental conditions

Salomi Rajendiran, Vignesh Palani, Bharathkumar Srinivasan